Rfastp 1.8.0
The Rfastp package provides an interface to the all-in-one preprocessing for FastQ files toolkit fastp(Chen et al. 2018).
Use the BiocManager package to download and install the package from
Bioconductor as follows:
if (!requireNamespace("BiocManager", quietly = TRUE))
    install.packages("BiocManager")
BiocManager::install("Rfastp")
If required, the latest development version of the package can also be installed from GitHub.
BiocManager::install("remotes")
BiocManager::install("RockefellerUniversity/Rfastp")
Once the package is installed, load it into your R session:
library(Rfastp)
The package contains three example fastq files, corresponding to a single-end fastq file, a pair of paired-end fastq files.
se_read1 <- system.file("extdata","Fox3_Std_small.fq.gz",package="Rfastp")
pe_read1 <- system.file("extdata","reads1.fastq.gz",package="Rfastp")
pe_read2 <- system.file("extdata","reads2.fastq.gz",package="Rfastp")
outputPrefix <- tempfile(tmpdir = tempdir())
Rfastp support multiple threads, set threads number by parameter thread.
se_json_report <- rfastp(read1 = se_read1, 
    outputFastq = paste0(outputPrefix, "_se"), thread = 4)
pe_json_report <- rfastp(read1 = pe_read1, read2 = pe_read2,
    outputFastq = paste0(outputPrefix, "_pe"))
pe_merge_json_report <- rfastp(read1 = pe_read1, read2 = pe_read2, merge = TRUE,
    outputFastq = paste0(outputPrefix, '_unpaired'),
    mergeOut = paste0(outputPrefix, "_merged.fastq.gz"))
umi_json_report <- rfastp(read1 = pe_read1, read2 = pe_read2, 
    outputFastq = paste0(outputPrefix, '_umi1'), umi = TRUE, umiLoc = "read1",
    umiLength = 16)
the following example will add prefix string before the UMI sequence in the sequence name. An "_" will be added between the prefix string and UMI sequence. The UMI sequences will be inserted into the sequence name before the first space.
umi_json_report <- rfastp(read1 = pe_read1, read2 = pe_read2, 
    outputFastq = paste0(outputPrefix, '_umi2'), umi = TRUE, umiLoc = "read1",
    umiLength = 16, umiPrefix = "#", umiNoConnection = TRUE, 
    umiIgnoreSeqNameSpace = TRUE)
Trim poor quality bases at 3’ end base by base with quality higher than 5; trim poor quality bases at 5’ end by a 29bp window with mean quality higher than 20; disable the polyG trimming, specify the adapter sequence for read1.
clipr_json_report <- rfastp(read1 = se_read1, 
    outputFastq = paste0(outputPrefix, '_clipr'),
    disableTrimPolyG = TRUE,
    cutLowQualFront = TRUE,
    cutFrontWindowSize = 29,
    cutFrontMeanQual = 20,
    cutLowQualTail = TRUE,
    cutTailWindowSize = 1,
    cutTailMeanQual = 5,
    minReadLength = 29,
    adapterSequenceRead1 = 'GTGTCAGTCACTTCCAGCGG'
)
rfastq can accept multiple input files, and it will concatenate the input files into one and the run fastp.
pe001_read1 <- system.file("extdata","splited_001_R1.fastq.gz",
    package="Rfastp")
pe002_read1 <- system.file("extdata","splited_002_R1.fastq.gz",
    package="Rfastp")
pe003_read1 <- system.file("extdata","splited_003_R1.fastq.gz",
    package="Rfastp")
pe004_read1 <- system.file("extdata","splited_004_R1.fastq.gz",
    package="Rfastp")
inputfiles <- c(pe001_read1, pe002_read1, pe003_read1, pe004_read1)
cat_rjson_report <- rfastp(read1 = inputfiles, 
    outputFastq = paste0(outputPrefix, "_merged1"))
pe001_read2 <- system.file("extdata","splited_001_R2.fastq.gz",
    package="Rfastp")
pe002_read2 <- system.file("extdata","splited_002_R2.fastq.gz",
    package="Rfastp")
pe003_read2 <- system.file("extdata","splited_003_R2.fastq.gz",
    package="Rfastp")
pe004_read2 <- system.file("extdata","splited_004_R2.fastq.gz",
    package="Rfastp")
inputR2files <- c(pe001_read2, pe002_read2, pe003_read2, pe004_read2)
catfastq(output = paste0(outputPrefix,"_merged2_R2.fastq.gz"), 
    inputFiles = inputR2files)
dfsummary <- qcSummary(pe_json_report)
p1 <- curvePlot(se_json_report)
p1
p2 <- curvePlot(se_json_report, curve="content_curves")
p2
dfTrim <- trimSummary(pe_json_report)
usage of rfastp:
?rfastp
usage of catfastq:
?catfastq
usage of qcSummary:
?qcSummary
usage of trimSummary:
?trimSummary
usage of curvePlot:
?curvePlot
Thank you to Ji-Dung Luo for testing/vignette review/critical feedback, Doug Barrows for critical feedback/vignette review and Ziwei Liang for their support. # Session info
sessionInfo()
## R version 4.2.1 (2022-06-23)
## Platform: x86_64-pc-linux-gnu (64-bit)
## Running under: Ubuntu 20.04.5 LTS
## 
## Matrix products: default
## BLAS:   /home/biocbuild/bbs-3.16-bioc/R/lib/libRblas.so
## LAPACK: /home/biocbuild/bbs-3.16-bioc/R/lib/libRlapack.so
## 
## locale:
##  [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C               LC_TIME=en_GB             
##  [4] LC_COLLATE=C               LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8   
##  [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                  LC_ADDRESS=C              
## [10] LC_TELEPHONE=C             LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C       
## 
## attached base packages:
## [1] stats     graphics  grDevices utils     datasets  methods   base     
## 
## other attached packages:
## [1] Rfastp_1.8.0     BiocStyle_2.26.0
## 
## loaded via a namespace (and not attached):
##  [1] Rcpp_1.0.9          highr_0.9           plyr_1.8.7          bslib_0.4.0        
##  [5] compiler_4.2.1      pillar_1.8.1        BiocManager_1.30.19 jquerylib_0.1.4    
##  [9] tools_4.2.1         digest_0.6.30       jsonlite_1.8.3      evaluate_0.17      
## [13] lifecycle_1.0.3     tibble_3.1.8        gtable_0.3.1        pkgconfig_2.0.3    
## [17] rlang_1.0.6         DBI_1.1.3           cli_3.4.1           magick_2.7.3       
## [21] yaml_2.3.6          xfun_0.34           fastmap_1.1.0       stringr_1.4.1      
## [25] dplyr_1.0.10        knitr_1.40          generics_0.1.3      sass_0.4.2         
## [29] vctrs_0.5.0         tidyselect_1.2.0    grid_4.2.1          glue_1.6.2         
## [33] R6_2.5.1            fansi_1.0.3         rmarkdown_2.17      bookdown_0.29      
## [37] farver_2.1.1        reshape2_1.4.4      ggplot2_3.3.6       magrittr_2.0.3     
## [41] scales_1.2.1        htmltools_0.5.3     assertthat_0.2.1    colorspace_2.0-3   
## [45] labeling_0.4.2      utf8_1.2.2          stringi_1.7.8       munsell_0.5.0      
## [49] cachem_1.0.6        rjson_0.2.21
Chen, Shifu, Yanqing Zhou, Yaru Chen, and Jia Gu. 2018. “fastp: an ultra-fast all-in-one FASTQ preprocessor.” Bioinformatics 34 (17): i884–i890. https://doi.org/10.1093/bioinformatics/bty560.